Thread by @DrEricDing

Pandemic profiteer @thermofisher is trying to monopolize the shortcut fast PCR test for the B117 #SARSCoV2 variant—& arrogantly chest thumping.

The truth? They found it by dumb luck & now hoarding & refusing to help scientists.

Let’s use hashtag: #thermofisherpandemicprofiteer

https://twitter.com/drericding/status/1344887673190817792

2) gene sequencing for finding the mutated virus is much slower and more expensive. But we need to test likely hundreds of thousands or millions to track down the new B117 variant. UK 🇬🇧 stumbled upon a short cut when it realized a special PCR can find mutated signal!

3) This special shortcut PCR test is called the Taqpath- and made by @thermofisher. They refuse to release the primer probe sequence to this shortcut test that can quickly find the 69-70 deletion of new B117 variant with the “S gene dropout” signal. @JoeBiden should invoke DPA.

4) Using Defense Production Act would force the formula of this TaqPath test from @thermofisher. But that is still weeks away.

We actually only discovered the Colorado B117 variant case because of this “S gene dropout” PCR test.

Hence lives being endangered by its withholding.

5) How easy is it? The genetic sequence code can literally fit inside one line of a tweet: @K_G_Andersen thinks it’s this genetic sequence fragment code for the primer probe. But @thermofisher won’t confirm or share this **literally one line** of code!

TGGAAAAGAAAGGTAAGAACAAGTCC

6) If we had the sequence, we can do dense mapping like this. But @thermofisher refuses to share for betterment of mankind. And remember they didn’t even design it for this, they found it by dumb luck accident. #thermofisherpandemicprofiteer

https://twitter.com/drericding/status/1341378634955841537

7) To be clear, @thermofisher did not “design” the TaqPath PCR test primers to the B117 variant. As @kakape points out, it was a “fortunate coincidence” it picked up the 69-70 deletion in the variant. Dumb luck basically. #thermofisherpandemicprofiteer

sciencemag.org/news/2020/12/m…

8) Tons of scientists are angry and complaining. Tons.

Fact is @thermofisher didn’t do anything novel to discover it, did not design it for variant, or optimize it for B117. They basically won a random lottery they didn’t buy a lottery ticket for. #thermofisherpandemicprofiteer

https://twitter.com/nathangrubaugh/status/1344631146332745728

9) Good news is a Yale team has developed new PCR protocols and primer to detect the B117 variant. But he laments, “All of this would be a lot easier if @thermofisher just shared their sequences”, because Nathan doesn’t have B117 virus to test with. #thermofisherpandemicprofiteer

https://twitter.com/nathangrubaugh/status/1344744633553858560

10) And do we have evidence @thermofisher has refused to help scientists? Oh yes, two scientists says that TF “wouldn’t tell us the target sequence of the probe” says @lea_starita, and TF “wouldn’t give us the probe sequence” says @NathanGrubaugh.

#thermofisherpandemicprofiteer

11) Ultimately, scientists will find a way and develop new PCR tests for the B117 variant. But the problem also is the time delay to validate a new test—since the TF one already has EUA. If TF shared, it would speed up worldwide detection of the more contagious variant. Shameful.