The Lancet are the main drivers for the whole #covid19 crisis. They published the complete lie that was the "zoonosis" paper of Peter Daszak and his chums.
The @TheLancetRheum also published this paper to discredit #hydroxychloroquine by @bengoldacre who refused to make the data public despite making his whole reputation on "scientific data transparency".
To complete the arms of the #covid19#event201 scenario for "global health" .@TheLancet were again used to create the insidious "Lancet Commission on vaccine refusal".
It first met in 2020, and Chelsea Clinton is its patron.
Surgo ventures (Sema Sgaier) is partnered with both the Clinton Foundation (yes the same one that took $2bn in charity money for #haiti and built 6 huts) and the BMGF.
And of course Art Caplan who has abrogated any pretence to uphold his specialty of medical ethics by promoting vaccine mandates using @Medscape as his vehicle, without declaring any of these conflicts on his Medscape page
Please feel free to add more context about the Lancet commission or its members, particularly where there are obvious undisclosed conflicts of interest.
The parallels to the Lancet "zoonosis commission" are uncanny.
Match to BGH [NM_180996.1]: (114/226bp)
CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC
So there are 112 bp in the BGH PolyA cassette which are not in the BGH gene transcript, and presumably make that cassette as efficient as the SV40 PolyA as described in Goodwin 1992...
@DiedSuddenly_ @JesslovesMJK @Kevin_McKernan Also note the "ribbon" pictures after nearly two years have none of the diatheses seen in the other images. Totally clean. After 499 days. 🙄
Sorry but this is not a believable study.
1⃣ ORCID ID record for Lee is blank, she is not a molecular biologist (& address does not validate)
2⃣ No ethics approval despite clinical samples (blood and semen - seriously?)
3⃣ Vials were incubated for a year without bacterial or fungal growth - these people have never done cell culture.
4⃣Quoting #Sashagate as a source in scientific paper is a massive red flag
My view reading this is:
This paper was submitted to the IJVTPR to discredit it because it's one of the few journals that allows criticism of pharmaceutical companies.
I'm happy to reconsider if you can find a valid publication record for Young Mi Lee at that address.
@DiedSuddenly_ A bowling alley?
I can't find any record of "Hanna Gynecologist Clinic" using that provided address either.
@SenatorRennick @TonyNikolic10 @BroadbentMP This website was used as the central evidence for the government in Kassam vs Hazzard, the first and most important vaccine mandate case in the Commonwealth.
It has gone.
Therefore the ruling is obsolete.
@tonynikolic10 @AaronSiriSG @barnes_law archive.is/dEBZ1
@JaninePaynter @PetousisH Following 4 years of enforced medical interventions does the public trust or distrust public health?
@JaninePaynter @PetousisH Always worth recording after the early polling and before the pharma companies send in their accounts.
It's like Georgia. Someone flood the polling station quick!
@JaninePaynter @PetousisH And here we have it.
The poll started off in one direction, and as soon as the pharma brigade got hold of it, it went the opposite way.
The problem is that they now have 19 hours to keep the bots going.
@elonmusk please make poll voting a 2-step interaction. TY.