Profile picture
Jon Rappoport
@jonrappoport
, 19 tweets, 13 min read Read on Twitter
HISTORIC Livestream Tonight: 7:30pm ET, Nov 26

#GeneEditSummit

In vitro (in the glass) genetic manipulation of artificially inseminated human eggs and sperms.

2nd: Hong Kong -- Nov, 27-29, 2018
nationalacademies.org/gene-editing/2…

1st: Wash DC -- Dec, 1-3, 2015
nationalacademies.org/gene-editing/G…
#GeneEditSummit Update 1 for citizen journalists covering 'medical': Definitely listen Dana Carroll's presentation (when archived). After listening, if it still seems too technical, then also read this book (learn their 'terms of art'!):

amazon.com/Crack-Creation…
#GeneEditSummit Update 2 for citizen journalists: transcript of Dana Carroll's presentation -- "genes genomes genetic variation" -- here: diyhpl.us/wiki/transcrip…

HT to @kanzure for the transcript.
#GeneEditSummit Update 3 for citizen journalists: follow @derek___so's live tweeting... Slightly technical, but will definitely stimulate your imagination to dig in! Full Speaker List here -- to ref his tweets against: nationalacademies.org/hk/index.html
#GeneEditSummit Update 4 for citizen journalists: Listen to Mohammed Ghaly's presentation (once archived) on the Islamic perspective of germline cell editing. Great way to transcend the 'amoral Western/ChiComm thought-box'... Summit Agenda via: nationalacademies.org/gene-editing/2…
#GeneEditSummit Update 5 for citizen journalists: referencing the "Lula and Nana" birth in China...
#GeneEditSummit Update 6 for citizen journalists: a question from audience member to "Social and Philosophical Reflections [...]" panel regarding (in vitro) "artificial wombs" for women not wishing to give birth as a (non-medical) lifestyle choice? Note to get archive/transcript.
7) #GeneEditSummit for citizen journalists: check out these two threads from biochemist Sam Sternberg (@shsternberg) regarding scientist Jiankui He and the "Lula and Nana" CRISPR babies allegedly born in China...



8) #GeneEditSummit LIVE STREAM 11/27, 10:30pm ET, 11:30am HK: panel on "Human Embryo Editing" will include Jiankui He -- the scientist behind "Lula and Nana" -- the genetically modified (CRISPR) IVF Chinese babies (twins)...

here: nationalacademies.org/gene-editing/2…
9) #GeneEditSummit Meet the Press...
10) #GeneEditSummit sidebar: Page 235 of "A Crack in Creation" (by Doudna, Sternberg) notes that, putting aside germline cell gene editing, "...the [40 year old] practice of in vitro fertilization [IVF]... never underwent formal clinical trials or FDA review." / [~4mil babies].
11) #GeneEditSummit Follow and read @derek___so and @kanzure
12) #GeneEditSummit LIVE STREAM: Jiankui He -- the scientist behind "Lulu and Nana" -- the genetically modified (CRISPR) IVF Chinese babies (twins) -- to speak soon... #CRISPRbabies #CRISPRbaby

here: livestream.com/accounts/70363…
13) #GeneEditSummit Day1, Session 2, 1h44m57s: atJennyMerchant asks atM_Balis...

"If artificial uteruses... become a reality one day will [that] solve all the gender problems and the heavy weight put on women to bear children?"

Answered at 1h48m29s.

nationalacademies.org/gene-editing/2…
14) #GeneEditSummit Day1, Session 3, 0h12m57s -- 0h31m45s: "Base" vs "CRISPR" gene editing

Not surprised to see (non-black budget) US Military (DARPA) monies behind open-source gene-editing research -- as evidenced here:

[at]DavidRLiu [at]BroadGenomics

nationalacademies.org/gene-editing/2…
15) #GeneEditSummit: "Lulu and Nana" twins: sterilization survey... #CRISPRbabies

16) #GeneEditSummit homework: Summit Bio of Kathy Niakan (of Crick) says she's 1st to use CRISPR on human [pre-implantation] embryos (see also Day2, Session3, Talk2). Book "Crack in Creation" (at pg214) says Junjiu Huang (of Guangzhou) was first.

nature.com/news/chinese-s…
17) #GeneEditSummit Parking this here for now. A must read investigation by @Preetika_Rana and @Lucy_Craymer. Much more on this later.

MUTANTS: Deformities Alarm Scientists Racing to Rewrite Animal DNA...

wsj.com/articles/defor…
18) #GeneEditSummit THE ANIMAL FARM: artificially inseminate sperm & egg in glass, germ-line gene-edit it using CRISPR, insert zygote into adult female. To bring forth offspring -- that make it to term, with $-margin-increasing 'traits' -- deformities notwithstanding...
Missing some Tweet in this thread?
You can try to force a refresh.

Like this thread? Get email updates or save it to PDF!

Subscribe to Jon Rappoport
Profile picture

Get real-time email alerts when new unrolls are available from this author!

This content may be removed anytime!

Twitter may remove this content at anytime, convert it as a PDF, save and print for later use!

Try unrolling a thread yourself!

how to unroll video

1) Follow Thread Reader App on Twitter so you can easily mention us!

2) Go to a Twitter thread (series of Tweets by the same owner) and mention us with a keyword "unroll" @threadreaderapp unroll

You can practice here first or read more on our help page!

Related hashtags

#GeneEditSummit #CRISPRbabies #CRISPRbaby

More from @jonrappoport see all

Profile picture
Jon Rappoport
@jonrappoport
#Vaxxed: From Cover-Up To Catastrophe

#Vaxxed II: The People's Truth

The mothers know...

Read 3 tweets
Profile picture
Jon Rappoport
@jonrappoport
"[Digital] libraries burn down during [info] wars." -- Alex Jones (August 11, 2018)
Adam Schiff wants FB to shadow-ban anti-vaccine content. Doesn't FB do that already? Developing...

schiff.house.gov/imo/media/doc/…
Vaccines cause brain damage.

The mothers know...

jonrappoport.wordpress.com/2019/02/15/vac…
Read 5 tweets
Profile picture
Jon Rappoport
@jonrappoport
Read 7 tweets

Related threads

Profile picture
Antonio Regalado
@antonioregalado
BREAKING: Any more babies out there? Big question at end of #geneeditsummit in HK

NEW==> Jiankui He registered a *second* study on PCSK9 (low heart disease risk)

Says only involves embryo (no transfer).but who knows.

H/t @erikwestin for inspiration

chictr.org.cn/showprojen.asp…
Let’s hear from @matthewherper about CRISPR babies versus Repatha. The baby approach will be more cost effective😝, but can’t undo ☹️
FYI, I think this trial listing discloses the prelim research on embryos both for CcR5 and pcsk9
Read 4 tweets
Profile picture
Gaetan Burgio
@GaetanBurgio
OK there are a lot to unravel in this He Jankui talk and panel discussion at the #GeneEditSummit on #CRISPR in human embryos leading to the birth of the twins Lulu and Nana. -> Let's analyze the science, the ethics and controversies -> thread
Let's start with the Science. The idea is to edit CCR5 gene, which is required for the HIV virus to enter into the cells. ∆32 mutation protects against HIV entry & is prevalent in many countries except China. The guide targeted ∆32 mutation sequence CAGAATTGATACTGACTGTA TGG
The guide was tested in Mouse, Monkey and human cell lines showed high efficiency and low off target effects
Read 24 tweets
Profile picture
Roo Bernascone♿🌈
@roo_b_arts
Tonight Saturday 10th Nov 9pm-3amish #tarotreading

Check it out 💜
Gonna be starting #readingswithroo about half 9 tonight (an hour from now) but will be talking about crystals tonight.

Specifically the crystals mentioned in Steven universe and their real world equivalents what they're associations and uses are.
Good evening folks!

It's Saturday 10th Nov the time is 9.30pm GMT and until 3am I am doing #tarotreading along with a #stevenuniverse #Crystal thread.

See link for #tarot details or DM me.

Read 38 tweets
Profile picture
Penny Midas Rollo
@PennyMidasRollo
001/ [article content in this tweet series 001-180 reproduced with permission from Martin Howe QC of Lawyers for Britain @lawyers4britain]
#quote "Leaving the EU on WTO terms: pulling down the barriers to world trade
Introduction: why prices will FALL after Brexit, not rise" /002
002/ #quote "Over the past couple of weeks, the media have been full of lurid scare stories about what will happen if the UK leaves the EU on WTO terms, because negotiations with the EU do not result in a withdrawal agreement." /003
#tariffs #NoDeal #Brexit #WTO #ProjectFear #shortages #food #medicines
003/ #quote "One of the most ridiculous and UNJUSTIFIED of these absurd scare stories is that it will lead to higher prices, and even shortages, of foods and medicines." /004
Read 180 tweets
Profile picture
Alexander Kruel
@XiXiDu
Genetic differences between human populations: more than meets the eye (link thread):
Indonesian Bajau divers have recently evolved 50% larger spleens for storing reserve of oxygenated blood needed in long dives dropbox.com/s/w5t351hboh14…
Greenlandic Inuit show genetic signatures of diet and climate adaptation science.sciencemag.org/content/349/62…
Read 44 tweets
Profile picture
CBC News Alerts
@CBCAlerts
Toronto Homicide Det.-Sgt. Hank Idsinga will give an update on the investigation involving accused serial killer Bruce McArthur this afternoon at 2 pm ET. He'll brief media near a house where police are searching for human remains.
Latest story @CBCNews on the challenges posed by the forensic search for digital evidence of landscaper Bruce McArthur's alleged murders: cbc.ca/1.4524991
Watch live: Police update investigation into suspected serial killer Bruce McArthur. cbc.ca/1.4526240
Read 6 tweets

Trending hashtags

#duty #WTO #lock #Italian #consumers #Vancouver #RepublicanSexualPredatorsWharton #French #economy #shortages #food #trade #GATT #geneeditsummit #prices #ChainofCommand #example #tariffs #Qanion #beef #EC #engine #penalties #billions #UraniumOne
Follow Us on Twitter!

Did Thread Reader help you today?

Support us! We are indie developers!

This site is made by just three indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3.00/month or $30.00/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!