Discover and read the best of Twitter Threads about #CRISPR

Most recents (15)

Well, there goes my day. 239 pages of federal document...

Let's discuss with #bioengineered hashtag. Start without me, I have a meeting soon.

[PDF] bit.ly/2QGH9gE
Pet food not included in label rule: "Therefore, although pet food and animal feed are “food” under the FDCA, such foods for animals are not covered by this regulation, pursuant to the amended Act. " pg 8. #bioengineered
"Other examples of “food” under the FDCA include dietary supplements, processing aids, and enzymes." pg 8. #bioengineered Oh, processing aids...does that mean enzymes like in cheese making...?
Read 47 tweets
1/ MORE @Comey #ClintonFoundation Connections...
“Real Estate Scandals” “HSBC” “DLA Piper: Major Donations Made To CF, Owned by Comeys Brother ‘Peter’” “Fake Climate Change Scandal!?!” And much more... @realDonaldTrump @GenFlynn #QAnon #WWG1WGA
👉🏻breitbart.com/politics/2016/…
2/ 💥THIS IS ALARMING @Comey covered up #IntellectualProperty Rights violations #China & requested back door access re: Apple Electronics, China for US surveillance Agencies!?? 😱is 👉🏻Treason? 😱 #QAnon #NSA #CIA #COG @realDonaldTrump @GenFlynn
👉🏻en.wikipedia.org/wiki/James_Com…
3/ We know what kind of Trouble The #ClintonCrime Syndicate recently got us all into with #IntellectualProperty theft of #CRISPR Technology, #DNAEdting, #NAFTA, #BioSimilars & #BigPharma 😱 @realDonaldTrump @GenFlynn #QAnon
💥💥💥A MUST READ
👉🏻
Read 8 tweets
Great work as usual by @edyong209 detailing the troubling missteps of the germline #CRISPR editing story of last week. Ed's #3 leaves a lot more to unpack, though, so here's a thread:
theatlantic.com/science/archiv…
Some have interpreted He’s work as a (failed) attempt to replicate the natural 32bp deletion, but I don’t think that was the goal. I think he just hypothesized that any old indel in this genetic region would get the job done and went for it. 2/
Obviously there’s a whole host of things to be concerned about here, but this approach was shockingly cavalier even within the limited scope of what’s known about loss of CCR5 function. 3/
Read 16 tweets
1/ WHAT IF I TOLD YOU OF A SECRET WAR, a war for control of “YOUR DNA?” What if they had the cures for many Diseases but instead used this knowledge to Create Illness Instead 😱 #VictimsForProfit
#DNAEditing #ReleaseTheCure #Matrix #QAnon #WWG1WGA
@realDonaldTrump @GenFlynn
2/ Each living Organism has it's own Genetic Code... #DNA is the Genetic Map of “YOU”. It holds detailed codes from your Parents/Ancestors, including your strengths & weaknesses...
#VictimsForProfit
#QAnon #WWG1WGA
@realDonaldTrump @GenFlynn
👉🏻en.wikipedia.org/wiki/DNA
3/ United States Department of Energy Cites “Q Clearance” as a “National Security Position” of “Critical & Sensitive Matters.” The #DOE had full Oversight of the
👉🏻#HumanGenomeProject 👈🏻 🤔
@realDonaldTrump @GenFlynn #WWG1WGA #QAnon #BioSimilars
👉🏻en.wikipedia.org/wiki/Q_clearan…
Read 41 tweets
OK there are a lot to unravel in this He Jankui talk and panel discussion at the #GeneEditSummit on #CRISPR in human embryos leading to the birth of the twins Lulu and Nana. -> Let's analyze the science, the ethics and controversies -> thread
Let's start with the Science. The idea is to edit CCR5 gene, which is required for the HIV virus to enter into the cells. ∆32 mutation protects against HIV entry & is prevalent in many countries except China. The guide targeted ∆32 mutation sequence CAGAATTGATACTGACTGTA TGG
The guide was tested in Mouse, Monkey and human cell lines showed high efficiency and low off target effects
Read 24 tweets
😱HOLY CRAP. A scientist in China claims to have genetically edited HEALTHY babies using #CRISPR. He Jiankui says he altered a gene in HEALTHY embryos before implanting them in the mother’s womb, with the goal of making babies resistant to HIV infection.
nytimes.com/2018/11/26/hea…
#CRISPR is a powerful gene editing tool that targets a gene to be "edited" and have its sequence changed. For several years, scientists have feared that CRISPR might be used to create "designer babies," in a new form of eugenics.😱

#crisprbabies
I can think of MULTIPLE genes that could be genetically altered to create "Super Humans" who have vastly increased strength and endurance. Forget performance enhancing drugs: if this report is true (and I have every reason to think that it is), then we've entered a whole new era.
Read 7 tweets
Has the brave new world of designer babies arrived? by @picardonhealth theglobeandmail.com/opinion/articl… via @GlobeDebate #CRISPR #bioethics #genomics
'Pandora’s box has been opened’: Scientist's baby gene-editing claim fuels backlash, by @KirstyLNeedham smh.com.au/world/asia/sci… via @smh @Kaubo #CRISPRbabies #genomics
Chinese scientist provokes furor with claim of world’s first genetically edited babies, by @nvanderklippe via @globeandmail #CRISPRbabies #genomics #bioethics
Read 14 tweets
So let's comment on these reports that came out today on the creation of the first #CRISPR babies from a team at Shenzhen, China reported here -> technologyreview.com/s/612458/exclu… or here -> apnews.com/4997bb7aa36c45… and this Youtube video
What we know about it? Well not much. 1/ They have edited CCR5 gene, which prevent HIV entry. Have they edited CCR5 to generate a ∆32 mutation? no idea. It looks they edited CCR5 in the pronuclear and check editing by sequencing 3-5 days later -> 16/22 edited and 11 implanted
Twins were born with one carrying an heterozygous allele and the second baby an homozygous allele and one carried mosaic alleles. Details? No off target found but I don't have any details on this too. Are the CCR5 protein level changed? Again very little details on this.
Read 10 tweets
Saturday Keynote at #ODSCWest Carrie Grimes Bostock - Data Science & Automated Decision Making. Automation has inputs, model(s) and potential outputs for action.
What is the goal of your models? Interpretability is important, but not the only thing. Other measures exist, but understanding your model is important to prevent outcomes, override recommendations, and to connect models to other systems - or stacks of models & systems. #ODSCWest
Example: placing racks in the Santa Clara data centre. Considerations, restrictions on space, power, future use of space, etc. Also: People install racks. They need to be able to intervene based on info that the placement model doesn't have. #ODSCWest
Read 29 tweets
✂️🐟🎉🏀 Hey everyone, @Science_Baller here! I'll be the guest host today talking about all things #STEMed #scioutreach #scicomm and #CRISPR today! Jump with questions at any time and I'll try to answer them! It's going to be a #zebrafishparty and I'm pumped! 😎
A little about myself: I am a new lecturer in Biological Sciences @VanderbiltU . I teach a section of Introductory Bio (220 students) and 3 sections of Intro Bio Lab (16 students/each). What's the biggest course you have had to teach? #STEMed #AcademicTwitter #phdlife #phdchat
I graduated with my Ph.D. in Biochemistry in May from @RiceUniversity . My research focused on #zebrafish genetics using #CRISPR mutagenesis. My big paper discussed a new #CRISPR tool that we developed which has an increased mutation rate+longer deletions onlinelibrary.wiley.com/doi/pdf/10.100…
Read 52 tweets
Finally the comments to Mitalipov’s group paper on #CRISPR in human embryos are out in @nature as well as the rebuttal from Ma et al. as brief communications arising #paywall. Let’s have a look more in details -> Thread
One of the major finding of the Ma et al. paper was the discovery of high frequency of inter-homologous repair mechanisms aka loss of heterozygocity LOH -> 1 allele is used as a template for
#CRISPR-HDR -> WT alleles are in fact alleles from the maternal alleles only.
We have been debating a lot on this in the last year or so. The first important comment from @Fatwa_Adikusuma et al is Ma et al. missed deleted alleles. In the paper they edited 6 loci in zygotes and EScells and checked for large deletions nature.com/articles/s4158…
Read 15 tweets
Hace una semana lanzé un HILO en el que explicaba los orígenes e información básica para entender las herramientas #CRISPR. Gracias a @jm_alarcon ese HILO está recogido en esta web: threadreaderapp.com/thread/9834491… Hoy continuaré con otro en el que hablaré de las aplicaciones. Dentro HILO
Las herramientas #CRISPR nos han cambiado tanto la vida a los investigadores de ciencias de la vida que prácticamente suelo decir que pronto solamente habrá dos tipos de laboratorio: (1) los que YA están usando CRISPR en sus experimentos y (2) los que VAN a usar CRISPR. Y ya está
Lo que está ocurriendo con las #CRISPR y la edición genética de alguna manera recuerda a lo que ocurrió a finales de los años 80, cuando apareció y se instaló la técnica de amplificación del ADN #PCR (reacción de la polimerasa en cadena) que está presente hoy en todas partes.
Read 38 tweets
En apenas 5 años (los primeros experimentos que demostraban su uso como editores genéticos aparecieron en enero de 2013) las herramientas #CRISPR han revolucionado los laboratorios de todo el mundo. Voy a intentar explicar por qué, de forma resumida. Vamos con el prometido HILO:
Voy a empezar por el final. Lo que hace a las #CRISPR unas herramientas sorprendentes es su aparente facilidad para promover cambios en el genoma, en el material genético de cualquier organismo. Recordemos que el ADN está formado por cadenas de letras (nucleótidos) A, T, G y C
El ADN es una doble cadena. La A siempre se empareja con la T, y la G con la C. Cada organismo tiene un número de letras específico. Nosotros tenemos aproximadamente 3.000 millones de letras. Por el contrario una bacteria como Escherichia coli tiene apenas 3 millones de letras.
Read 38 tweets
Voy a explicar en un HILO las consecuencias científicas (y otras) derivadas de la publicación, el 30 de mayo de 2017, de un artículo en Nature Methods que concluía que el uso de #CRISPR en ratones producía miles de mutaciones inesperadas en todo el genoma ncbi.nlm.nih.gov/m/pubmed/28557…
Al día siguiente, 31 de mayo, un primer medio @ConversationUS se hizo eco del artículo y empezó a difundir los temores y el alarmante número de mutaciones que parecían derivarse inesperadamente de la utilización de las herramientas #CRISPR en ratones theconversation.com/crispr-controv…
3 días más tarde el genetista @GaetanBurgio publicó un primer comentario crítico con el estudio de Nat Methods, resaltando el inusualmente bajo número de ratones utilizados (2 ratones editados, un control) como uno de los problemas principales del trabajo medium.com/@GaetanBurgio/…
Read 14 tweets
Today, we are celebrating the achievements of women in science, technology, engineering & maths ow.ly/rR2u30fLxVd #AdaLovelaceDay
For #AdaLovelaceDay, we’ll be highlighting the many wonderful #womeninstem that help us understand the world today ow.ly/ehEe30fLzDU
Pratiwi Sudarmono is professor of microbiology @univ_indonesia & the first Indonesian astronaut ow.ly/Djsn30fzS5g #AdaLovelaceDay
Read 55 tweets

Related hashtags

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just three indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3.00/month or $30.00/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!