Profile picture
Antonio Regalado @antonioregalado
, 7 tweets, 3 min read Read on Twitter
Today's brawl in Nature over whether editing human embryos with CRISPR really happened or not. technologyreview.com/s/611837/us-sc…
Here's some links for people who like details:
Original Aug 2017 paper by Mitalipov: nature.com/articles/natur…
Press coverage:
technologyreview.com/s/608350/first…
Doubts raised that same month:
nature.com/news/doubts-ra…
Today, critiques officially published

"Inter-homologue repair in fertilized human eggs?" by Dieter Egli & Maria Jasin: nature.com/articles/s4158…

"Large deletions induced by Cas9 cleavage" by Fatwa Adikusuma and Paul Thomas
nature.com/articles/s4158…
Lengthy 14 page reply to the critiques above, also today, by Mitalipov team.
nature.com/articles/s4158…
Previously, a preprint supporting Mitalipov's finding from Guoping Feng at MIT.
"RAD51 Enhances Zygotic Interhomolog Repair"
biorxiv.org/content/early/…
Also previously, a small N embryo editing paper from China that did not find support for Mitalipov. ncbi.nlm.nih.gov/pubmed/29624775 "Highly efficient ssODN-mediated homology-directed repair of DSBs generated by CRISPR/Cas9 in human 3PN zygotes."

/END
Coupla tweet storms from 1st author of Rad51 preprint.
Missing some Tweet in this thread?
You can try to force a refresh.

Like this thread? Get email updates or save it to PDF!

Subscribe to Antonio Regalado
Profile picture

Get real-time email alerts when new unrolls are available from this author!

This content may be removed anytime!

Twitter may remove this content at anytime, convert it as a PDF, save and print for later use!

Try unrolling a thread yourself!

how to unroll video

1) Follow Thread Reader App on Twitter so you can easily mention us!

2) Go to a Twitter thread (series of Tweets by the same owner) and mention us with a keyword "unroll" @threadreaderapp unroll

You can practice here first or read more on our help page!

More from @antonioregalado see all

Profile picture
"A lot of sharp problems caused fierce debates on the spot, and the smell of gunpowder was full." --from CRISPR baby maker Jiankui He's blog after attending attending Jennifer Doudna's closed-door gene-edit meeting in February 2017

blog.sciencenet.cn/blog-514529-10…
From He's blog, hanging with the CRISPR inventor in August 2016 at the CSHL meeting. blog.sciencenet.cn/home.php?mod=s…
Early on, He was interested in getting hold of some dinosaur eggs. If there were any DNA fragments inside, maybe he could sequence them.

"Who has a dinosaur egg, lend me one" blog.sciencenet.cn/blog-514529-80…
Read 6 tweets
Profile picture
Rogue or team player? The complex before and after reaction to He Jiankui in China.

“A milestone accomplishment China has achieved in the area of gene-editing technologies” -People's Daily, November 26th, 2018.

Since deleted from internet.

(thread)
Everyone is condemning He Jiankui right now---everyone in China saying they knew nothing about the CRISPR baby project. Yet it is more likely that many, including in government did know.
JK He had started 7 biotech companies and had millions in research grants. That's the kind of person a lot of people will know. We also know in 2017 He widely advertised his interest in making a baby to US scientists and geneticists. Seems likely he did the same in China.
Read 16 tweets
Profile picture
BREAKING: Any more babies out there? Big question at end of #geneeditsummit in HK

NEW==> Jiankui He registered a *second* study on PCSK9 (low heart disease risk)

Says only involves embryo (no transfer).but who knows.

H/t @erikwestin for inspiration

chictr.org.cn/showprojen.asp…
Let’s hear from @matthewherper about CRISPR babies versus Repatha. The baby approach will be more cost effective😝, but can’t undo ☹️
FYI, I think this trial listing discloses the prelim research on embryos both for CcR5 and pcsk9
Read 4 tweets

Related threads

Profile picture
OK there are a lot to unravel in this He Jankui talk and panel discussion at the #GeneEditSummit on #CRISPR in human embryos leading to the birth of the twins Lulu and Nana. -> Let's analyze the science, the ethics and controversies -> thread
Let's start with the Science. The idea is to edit CCR5 gene, which is required for the HIV virus to enter into the cells. ∆32 mutation protects against HIV entry & is prevalent in many countries except China. The guide targeted ∆32 mutation sequence CAGAATTGATACTGACTGTA TGG
The guide was tested in Mouse, Monkey and human cell lines showed high efficiency and low off target effects
Read 24 tweets
Profile picture
So let's comment on these reports that came out today on the creation of the first #CRISPR babies from a team at Shenzhen, China reported here -> technologyreview.com/s/612458/exclu… or here -> apnews.com/4997bb7aa36c45… and this Youtube video
What we know about it? Well not much. 1/ They have edited CCR5 gene, which prevent HIV entry. Have they edited CCR5 to generate a ∆32 mutation? no idea. It looks they edited CCR5 in the pronuclear and check editing by sequencing 3-5 days later -> 16/22 edited and 11 implanted
Twins were born with one carrying an heterozygous allele and the second baby an homozygous allele and one carried mosaic alleles. Details? No off target found but I don't have any details on this too. Are the CCR5 protein level changed? Again very little details on this.
Read 10 tweets
Profile picture
✂️🐟🎉🏀 Hey everyone, @Science_Baller here! I'll be the guest host today talking about all things #STEMed #scioutreach #scicomm and #CRISPR today! Jump with questions at any time and I'll try to answer them! It's going to be a #zebrafishparty and I'm pumped! 😎
A little about myself: I am a new lecturer in Biological Sciences @VanderbiltU . I teach a section of Introductory Bio (220 students) and 3 sections of Intro Bio Lab (16 students/each). What's the biggest course you have had to teach? #STEMed #AcademicTwitter #phdlife #phdchat
I graduated with my Ph.D. in Biochemistry in May from @RiceUniversity . My research focused on #zebrafish genetics using #CRISPR mutagenesis. My big paper discussed a new #CRISPR tool that we developed which has an increased mutation rate+longer deletions onlinelibrary.wiley.com/doi/pdf/10.100…
Read 52 tweets
Profile picture
Finally the comments to Mitalipov’s group paper on #CRISPR in human embryos are out in @nature as well as the rebuttal from Ma et al. as brief communications arising #paywall. Let’s have a look more in details -> Thread
One of the major finding of the Ma et al. paper was the discovery of high frequency of inter-homologous repair mechanisms aka loss of heterozygocity LOH -> 1 allele is used as a template for
#CRISPR-HDR -> WT alleles are in fact alleles from the maternal alleles only.
We have been debating a lot on this in the last year or so. The first important comment from @Fatwa_Adikusuma et al is Ma et al. missed deleted alleles. In the paper they edited 6 loci in zygotes and EScells and checked for large deletions nature.com/articles/s4158…
Read 15 tweets
Profile picture
Today is the 6th Friday of the #GreatReturnMarch. Last Friday there was a more organized attempt to reach the #GazaFence & Israeli army promised to respond harsher. Israel also declared human rights laws do not apply to the protesters. 48 killed & ~7,000 wounded so far in Gaza
Meanwhile, Giro d'Italia 2018, the biggest sporting event in Israeli history, begins today (& Israelis bitch about the traffic)
haaretz.com/israel-news/gi…
#normalization
Read 73 tweets
Profile picture
Voy a explicar en un HILO las consecuencias científicas (y otras) derivadas de la publicación, el 30 de mayo de 2017, de un artículo en Nature Methods que concluía que el uso de #CRISPR en ratones producía miles de mutaciones inesperadas en todo el genoma ncbi.nlm.nih.gov/m/pubmed/28557…
Al día siguiente, 31 de mayo, un primer medio @ConversationUS se hizo eco del artículo y empezó a difundir los temores y el alarmante número de mutaciones que parecían derivarse inesperadamente de la utilización de las herramientas #CRISPR en ratones theconversation.com/crispr-controv…
3 días más tarde el genetista @GaetanBurgio publicó un primer comentario crítico con el estudio de Nat Methods, resaltando el inusualmente bajo número de ratones utilizados (2 ratones editados, un control) como uno de los problemas principales del trabajo medium.com/@GaetanBurgio/…
Read 14 tweets

Trending hashtags

#epigenetica #bias #scam #TheGreatAwkaening #Dutch #research #CRISPRbabies #transplant #video #PSA #EmbraceUnity #photos #LockThemAllUp #accountability #TeamDeza #Russia #Unite #update #ExoCas9 #Astrakhan #TrumpWorld #Kiev #Giro101 #grintechnologies #donations

Did Thread Reader help you today?

Support us! We are indie developers!

This site is made by just three indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member and get exclusive features!

Premium member ($3.00/month or $30.00/year)

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!