Discover and read the best of Twitter Threads about #crispr

Most recents (24)

Breaking↘️ @US_FDA Finds Unexpected Antibiotic Resistance #AMR #Genes in ‘Gene-Edited’ Dehorned #Cattle: "The @Recombinetics gene-edited cattle do contain #DNA unnatural to cattle". independentsciencenews.org/news/fda-finds… @Act4AnimalsEU
@US_FDA @Recombinetics @Act4AnimalsEU "FDA’s demonstration that gene-editing techniques can introduce foreign DNA is likely to be seen as a significant blow to the no-regulation argument. It is also a powerful vindication of the #EU approach, which is to regulate gene-edited organisms as #GMOs."
@US_FDA @Recombinetics @Act4AnimalsEU This is one more and very compelling argument to be critical of #CRISPR technologies to genetically modify animals. We recently expressed more criticism here, with regard to using gene editing to prevent puberty in #pigs: allianceforscience.cornell.edu/blog/2019/07/a…
Read 3 tweets
"Comment nourrir le monde sans détruire la planète?"

Joli challenge !

🇫🇷 translate.google.com/translate?hl=f…

🔽

How to feed the world without destroying the planet on.natgeo.com/2JKnRRl

En vérité, ceux qui me suivent en ont déjà entendu parler .../

⤵️
/...
Un pré-rapport avait été sorti en Décembre dernier, j'en avais fait un résumé :



Le rapport plus complet (564 pages) est disponible là :
sustainablefoodfuture.org/sites/default/…

Encore une fois, comme en Décembre, l'information ne sera probablement pas diffusée. 😔
Dans son interview, @waiterich insiste une nouvelle fois sur la nécessité d'augmenter la productivité de l'agriculture mondiale.

C'est la notion de land-Sparing : Produire sur le plus faible espace possible pour minimiser l'impact de l'agriculture sur la Biodiversité.

⤵️
Read 15 tweets
Et puisque ça parle de recherche génétique, regardons un peu ce qui se passe du côté de l'édition génétique à vocation agricole et alimentaire

C'est l'objet de cette publication :

…ntalevidencejournal.biomedcentral.com/track/pdf/10.1…

Quelques petits graphiques à extraire.

#CRISPR

⤵️
Tout d'abord, on voit que l'édition génétique est en train de bousculer la recherche sur l'agriculture.

Le nombre de publications prend une courbe exponentielle :

PS : 2018, ce sont des résultats partiels (5 mois)

⤵️
Qui publie sur l'édition génétique à vocation agricole?

2 pays se taillent la part du lion : la Chine et les USA bien sûr.

Quelques publications Françaises mais on est très loin de rivaliser.
Même les allemands publient 3 fois plus que nous :

⤵️
Read 11 tweets
In this article, we express our critical position towards using #CRISPR to engineer #pigs so that do not reach puberty. #Livestock farming should be designed with animal sentience at its core, we should not modify #animals to fit inhumane systems. allianceforscience.cornell.edu/blog/2019/07/a…
One aspect that the article does not mention and that we clearly indicated as being problematic is animal suffering during #experiments involving #CRISPR: painful #malformations, #abortions, are common "side effects" of such experiments.
Our original statement said "#CRISPR has a high potential for causing severe #animal #suffering during the research phases (such as abortions, perinatal mortality, malformations)
Read 6 tweets
Hoy voy a contar en un hilo mi charla del @pintofscienceES #Pint19TFE para aquellos q no pudieron ir
Se llama "Transgénicos naturales. No hemos inventado nada" donde repaso los casos de Transferencia horizontal de genes (THG) q he visto durante mientras investigaba en el lab
Y empiezo con esta imagen preguntando al público si creen q alguno de estos es un transgénico
Hay una encuesta en el siguiente tweet por si alguien quiere participar (las respuestas, al final del hilo)
¿Ves algún transgénico en esa imagen?
Read 43 tweets
India (Bhārat), aka Republic of India (Bhārat Gaṇarājya) constitutes a mosaic of paradoxes and contradictions starting with the existence of gigantic socio-economic disparities which are in sharp contrast with the spectacular technological development in most productive sectors.
Such contradictions reflect significant measurement discrepancies which, in India's case, could be on the order of hundreds of millions of people.
Furthermore, there is the problem of Islamic terrorists, who are trained abroad and find easy fuel in the contradictions within it.
Finally, there’s agriculture which, by some estimates, accounts for 90% of India’s water consumption. Farmers meet irrigation demands by indiscriminately extracting groundwater, which some say accounts for a quarter of the world’s groundwater usage.
Read 134 tweets
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) è il nome di una famiglia di segmenti DNA contenenti brevi sequenze ripetute. La versione semplificata CRISPR/Cas9 fornisce un precisissimo strumento per modificare permanentemente i geni di molteplici organismi.
Unraveling a genetic network linked to autism

#CRISPR #DNA #RNA #mRNA #genetics #autism

medicalxpress.com/news/2018-11-u…
Largest study of CRISPR-Cas9 mutations creates prediction tool for gene editing. #OneGiantLeap

#CRISPR #DNA #RNA #GeneEditing #MachineLearning #Biotechnology #FORECasT

phys.org/news/2018-11-l…
Read 15 tweets
Così i #broccoli possono “spegnere” l’enzima che fa crescere i #tumori più comuni. #OneGiantLeap

Nuovo studio italiano pubblicato su «Science» dimostra come le crucifere contribuiscano ad abbattere il rischio di sviluppare un cancro. È un primo passo.

lastampa.it/2019/05/16/sci…
La famiglia di piante delle crucifere può anche essere chiamata brassicaceae e comprende:

🥦 Broccoli
🥦 Cavolfiore
🥦 Cavolo cappuccio
🥦 Cavolo nero
🥦 Cavolo verza
🥦 Cime di rapa
🥦 Crescione
🥦 Ravanelli

🥗 google.it/search?q=brocc…
Reactivation of PTEN tumor suppressor for cancer treatment through inhibition of a MYC-WWP1 inhibitory pathway

"We identified indole-3-carbinol, a compound found in cruciferous vegetables, as a natural and potent WWP1 inhibitor."

🧬 science.sciencemag.org/content/364/64…
Read 13 tweets
In July 1969 the Apollo 11 astronauts conducting several tasks during extravehicular activity (EVA) operations on the surface of the moon. The EVA lasted approximately 2.5 hours with all scientific activities being completed satisfactorily. #OneGiantLeap

#Apollo11 landed on the Moon on July 20, 1969.

That's #OneSmallStep for [a] man, #OneGiantLeap for mankind.

Read 54 tweets
BRIEF ANSWERS TO THE BIG QUESTIONS

The final book from one of the greatest minds in history, is a personal view on the challenges we face as a human race, and where we, as a planet, are heading next. A percentage of all royalties will go to charity.

🕳️ en.wikipedia.org/wiki/Brief_Ans…
#IntelligenzaArtificiale: “potrebbe sviluppare una volontà propria in conflitto con la nostra."
#CRISPR: "potrebbe portare alla nascita di una nuova specie di 'superumani' che soppianterebbe la nostra."
#Asteroidi: “Non abbiamo ancora alcuna difesa contro minacce di questo tipo”.
Read 26 tweets
Last day of #Microbio19 and #antibioticmakers session! Chair @kate_duncan and #ECMForum CoChair @Becca_McHugh introducing the morning session and first speaker
First speaker #antibioticsmakers #microbio19 is @NadineZiemert discussing her lab's work on novel tools and methods for #genomemining for prioritizing which biosynthetic gene clusters to follow up on for novel #bioactives #discovery
Nadine @NadineZiemert shows automated tools to find new antibiotic targets, and many other cool tools for screening genomes on antibiotic related info
Read 27 tweets
This @NatureMedicine paper shows 1 year after IM injection of #CRISPR AAV-SaCas9 for DMD:
-> editing event still occur 6 months after IM
-> immune response is seen within weeks & sustained
- on-target effects < 5% with AAV integration in genome

#paywall
nature.com/articles/s4159…
@NatureMedicine I have additional comments on this paper:

1/ it is great to see a year follow up after AAV injection. Important to see more of those.

2/ Immunogenicity of AAV and Cas9 are now well documented and this work confirm it. Interestingly Neonatal injection seems to overcome it
3/ Off target effects are minimal & again in line with previously reports (Table S1 & S2)

4/ Interestingly they found on-target effects with deletion, integration of AAV or increase circular RNA. Nextera technique is interesting. Would have loved to see some long read sequencing
Read 4 tweets
Today I received a parcel I wasn't expected from my friend @LluisMontoliu. I had no idea what it was and was intrigued to discover what it could be. So I opened it.
@LluisMontoliu What a wonderful surprise ! @LluisMontoliu 's book on #CRISPR ! I am so grateful to have received it from such a great friend and looking so much forward to read it (although I will need help from my wife for Spanish to French/English translation). Please buy the book !
Read 3 tweets
Les quiero contar algo sobre virus, arqueas, las archifamosas #CRISPR, Alicante y heces.

En 2015, investigadores estadounidenses analizaron las muestras de heces de personas americanas, francesas, gambianas y hasta de simios del zoo de San Francisco. Todas las muestras
procedían de individuos y animales que sufrieron brotes de diarrea típicos de una gastroenteritis viral.

Al determinar el #virioma en la muestras de heces (todos los virus presentes), notaron que una alta incidencia de un virus desconocido para la ciencia.
Lo llamaron smacovirus. Estos virus son realmente diminutos, su genoma es de apenas 2.5 Kb.

Para que tengan una idea, el genoma del VIH es de 9.2 Kb, el de zika de 11 Kb y el del ébola de 18 Kb, aproximadamente.

Sin embargo, no pudieron infectar ratones con #smacovirus.
Read 14 tweets
So the #CRISPR2019 conference program is up crispr2019.org & to my knowledge this is the first time in a #CRISPR conference there are more women invited speakers than men (13/21) crispr2019.org/invited-speake…. Kudos to the organizers @smoineau @theMaxwellLab et al...
Theoretically It shouldn't be too hard to organise a conference with 50/50 ratio men/women invited speakers. However for some reason the average ratio for a CRISPR conference is 20 to 30% and always the same persons are invited.
I have observed a very low diversity of talks + speakers on those conferences whereas there are tones of talented women and other people to those regularly invited working in the #CRISPR field
Read 4 tweets
This is a very interesting paper that came out in @CellCellPress on the generation of #CRISPR Cas9 variants by circular permutation (Cp-Cas9). Addition of a linker to a protease aka ProCas9 controls it activity to respond to viral infection cell.com/cell/fulltext/…
OK I have now a bit of time to elaborate more on this paper. What I like in this paper is the protein chemistry experiments displayed. I found the circular permutation with a peptide linker + screening technique really nice & very interesting to see CP on RuVC domain.
The replacement of the linker with a site specific protease sequence to render the Cas9 switchable is a really nice idea and clever.
Read 6 tweets
Well, there goes my day. 239 pages of federal document...

Let's discuss with #bioengineered hashtag. Start without me, I have a meeting soon.

[PDF] bit.ly/2QGH9gE
Pet food not included in label rule: "Therefore, although pet food and animal feed are “food” under the FDCA, such foods for animals are not covered by this regulation, pursuant to the amended Act. " pg 8. #bioengineered
"Other examples of “food” under the FDCA include dietary supplements, processing aids, and enzymes." pg 8. #bioengineered Oh, processing aids...does that mean enzymes like in cheese making...?
Read 47 tweets
1/ MORE @Comey #ClintonFoundation Connections...
“Real Estate Scandals” “HSBC” “DLA Piper: Major Donations Made To CF, Owned by Comeys Brother ‘Peter’” “Fake Climate Change Scandal!?!” And much more... @realDonaldTrump @GenFlynn #QAnon #WWG1WGA
👉🏻breitbart.com/politics/2016/…
2/ 💥THIS IS ALARMING @Comey covered up #IntellectualProperty Rights violations #China & requested back door access re: Apple Electronics, China for US surveillance Agencies!?? 😱is 👉🏻Treason? 😱 #QAnon #NSA #CIA #COG @realDonaldTrump @GenFlynn
👉🏻en.wikipedia.org/wiki/James_Com…
3/ We know what kind of Trouble The #ClintonCrime Syndicate recently got us all into with #IntellectualProperty theft of #CRISPR Technology, #DNAEdting, #NAFTA, #BioSimilars & #BigPharma 😱 @realDonaldTrump @GenFlynn #QAnon
💥💥💥A MUST READ
👉🏻
Read 8 tweets
Great work as usual by @edyong209 detailing the troubling missteps of the germline #CRISPR editing story of last week. Ed's #3 leaves a lot more to unpack, though, so here's a thread:
theatlantic.com/science/archiv…
Some have interpreted He’s work as a (failed) attempt to replicate the natural 32bp deletion, but I don’t think that was the goal. I think he just hypothesized that any old indel in this genetic region would get the job done and went for it. 2/
Obviously there’s a whole host of things to be concerned about here, but this approach was shockingly cavalier even within the limited scope of what’s known about loss of CCR5 function. 3/
Read 16 tweets
1/ WHAT IF I TOLD YOU OF A SECRET WAR, a war for control of “YOUR DNA?” What if they had the cures for many Diseases but instead used this knowledge to Create Illness Instead 😱 #VictimsForProfit
#DNAEditing #ReleaseTheCure #Matrix #QAnon #WWG1WGA
@realDonaldTrump @GenFlynn
2/ Each living Organism has it's own Genetic Code... #DNA is the Genetic Map of “YOU”. It holds detailed codes from your Parents/Ancestors, including your strengths & weaknesses...
#VictimsForProfit
#QAnon #WWG1WGA
@realDonaldTrump @GenFlynn
👉🏻en.wikipedia.org/wiki/DNA
3/ United States Department of Energy Cites “Q Clearance” as a “National Security Position” of “Critical & Sensitive Matters.” The #DOE had full Oversight of the
👉🏻#HumanGenomeProject 👈🏻 🤔
@realDonaldTrump @GenFlynn #WWG1WGA #QAnon #BioSimilars
👉🏻en.wikipedia.org/wiki/Q_clearan…
Read 41 tweets
OK there are a lot to unravel in this He Jankui talk and panel discussion at the #GeneEditSummit on #CRISPR in human embryos leading to the birth of the twins Lulu and Nana. -> Let's analyze the science, the ethics and controversies -> thread
Let's start with the Science. The idea is to edit CCR5 gene, which is required for the HIV virus to enter into the cells. ∆32 mutation protects against HIV entry & is prevalent in many countries except China. The guide targeted ∆32 mutation sequence CAGAATTGATACTGACTGTA TGG
The guide was tested in Mouse, Monkey and human cell lines showed high efficiency and low off target effects
Read 24 tweets
😱HOLY CRAP. A scientist in China claims to have genetically edited HEALTHY babies using #CRISPR. He Jiankui says he altered a gene in HEALTHY embryos before implanting them in the mother’s womb, with the goal of making babies resistant to HIV infection.
nytimes.com/2018/11/26/hea…
#CRISPR is a powerful gene editing tool that targets a gene to be "edited" and have its sequence changed. For several years, scientists have feared that CRISPR might be used to create "designer babies," in a new form of eugenics.😱

#crisprbabies
I can think of MULTIPLE genes that could be genetically altered to create "Super Humans" who have vastly increased strength and endurance. Forget performance enhancing drugs: if this report is true (and I have every reason to think that it is), then we've entered a whole new era.
Read 7 tweets
Has the brave new world of designer babies arrived? by @picardonhealth theglobeandmail.com/opinion/articl… via @GlobeDebate #CRISPR #bioethics #genomics
'Pandora’s box has been opened’: Scientist's baby gene-editing claim fuels backlash, by @KirstyLNeedham smh.com.au/world/asia/sci… via @smh @Kaubo #CRISPRbabies #genomics
Chinese scientist provokes furor with claim of world’s first genetically edited babies, by @nvanderklippe via @globeandmail #CRISPRbabies #genomics #bioethics
Read 14 tweets

Related hashtags

Did Thread Reader help you today?

Support us! We are indie developers!


This site is made by just three indie developers on a laptop doing marketing, support and development! Read more about the story.

Become a Premium Member ($3.00/month or $30.00/year) and get exclusive features!

Become Premium

Too expensive? Make a small donation by buying us coffee ($5) or help with server cost ($10)

Donate via Paypal Become our Patreon

Thank you for your support!